Microsoft word - yindesuo4.doc

Rice Science, 2007, 14(3): 235-238 Copyright 2007, China National Rice Research Institute. Published by Elsevier BV. All rights reserved
Identification of a Herbicide Safener AD-67 Inducible cDNA in Rice
YIN De-suo1, 2, SUN Xiao-qiong3, LI Ke1, 2, WANG Shi-quan1, 2, DENG Qi-ming1, 2, LI Ping1, 2 (1 Rice Research Institute, Sichuan Agricultural University, Wenjiang 611130, China; 2 Key Laboratory of Southwest Crop Genetic Resource and Improvement, Sichuan Agricultural University, Ministry of Education, Ya’an 625014, China; 3 Sichuan Agricultural University High-Tech CO., LTD, Wenjiang 611130, China) Abstract: A herbicide safener AD-67 inducible cDNA was identified in an indica rice variety 9311 by mRNA differential display. The
transcript was increased 6 h after sprayed with the safener solution, and 4 days later, the expression still could be detected. The fragment was recycled from the poly-gel and sequenced, and homologous analysis revealed the cDNA was 100% identical to some ESTs and cDNAs in rice database, and the amino acid sequence was 60-84% homologous to those of the Yippee genes in several eukaryotes. The fragment was extended to the whole long cDNA, and thus a primer pair was designed. RT-PCR analysis for the designed primer supported the induction result. Key words: rice; chemical induction; cDNA; mRNA differential display; herbicide safener; inducible gene
Chemical inducible promoter, as a tool of controlling gene specific gene expression in plant without affecting growth and expression, is important for plant research in laboratory and development maybe still an effective way for discovering new field application. The chemical inducible system can control transgene expression both temporally and spatially, which has AD-67 is a safener widely used in maize herbicide EPTC an advantage to the old systems including the constitutive (S-ethyl dipropylcarbamothioate). However, few reports promoter and tissue specific promoter systems. This made the revealed its mechanism and inducible gene. In this study, the system become a new and powerful strategy for gene safener was used as the inducer to detect inducible gene. analysis [1-2]. After Gatz and Quail first reported the tetracycline induction system in 1988 [3], several induction systems were MATERIALS AND METHODS
established and developed, such as copper, ethanol, glucocorticoid, estrogen, ecdysone agonist, benzothiadiazole Growth of rice seedlings
(BTH) and safener inducible systems [3-10]. These systems have some applications in laboratory, but not yet in field due to Seeds of rice variety 9311 were sterilized in 0.1% HgCl2 for 5 min and rinsed with sterile water, and then planted into Herbicide safeners selectively protect crop plant from growth chamber with cool-white fluorescent lamps under a herbicide damage without reducing activity in target weed photoperiod of 16 h/8 h (light/dark), 28℃ and a humidity of species. The working mechanism of safener is not very clear, 85%. The seedlings were cultured in MS liquid medium and several hypotheses were established to explain how the grown over three weeks when the third leaves fully expanded. safeners prevent the detrimental effects of herbicide, but many At this stage, the plants are more sensitive to exogenous studies produced inconsistent results. Generally, safener could increase crop tolerance to herbicide [12]. The activities of some genes were increased when plant was treated with safener, such Treatment with AD-67 and extraction of total RNA
as the cytochrome P450 and glutathione S-transferases (GST) Rice seedlings were treated by foliar spray with solution genes, but these genes were constitutively or temporally of AD-67 (3 g/L) in acetone, with acetone as the control. All of expressed with development [13]. In 1991, Hershey’s group the leaves were collected at 6 h, 12 h, 1 d, 2 d, 3 d, 4 d and 5 d isolated two genes induced by benzenesulfonamide herbicide after the treatments and stored at -80 ℃. Total RNA was safener in maize, and the safener was used as a promoter to extracted using Trizol agent (TaKaRa) according to the develop a new inducible gene expression system for plant [14]. manufacturer instruction. After digestion by DNase, the RNA This suggests that searching of compounds capable of inducing was resuspended in DEPC water and diluted to 1 µg/µL, then Received: 5 March 2007; Accepted: 6 July 2007
Corresponding author: LI Ping ([email protected])
Synthesis of the first strand cDNA
This paper was translated from its Chinese version in Chinese Journal of Rice Science, Vol. 21, No. 4, 2007, Pages 439-442. Synthesis procedure was according to Promega M-MLV manufacturer instructions. The 25 µL reaction system contained Sequencing and RT-PCR analysis
2 µg RNA, 40 pmol anchor primer, 5 µL 5×RT buffer, 10 Nucleic acid and protein homology searches were mol/L dNTPs of 5 µL, 25 U RNasin, 200 U M-MLV. The total performed using the BLAST program at National Center of RNA and primer were incubated at 70℃ for 5 min, followed Biotechnology Information. Some data scanning were by adding other components. The mixture was incubated at conducted with DNAMAN6.0 bioinformatics software. Primers 42℃ for 1 h to complete the reaction, then at 95℃ for 10 min responding to the cDNA were designed by Primer5.0, and to end the reaction. Finally, the mixture was diluted to 100 µL RT-PCR was carried out to check the expression of cDNA. Two primers designed for RT-PCR were: Yipa, 5’CAGCAAAC Differential display
CCATCAATC 3’; Yips, 5’TGGTCCTCGCCA GATA 3’. The first strand cDNA products were used for PCR amplification with three anchor primers and twelve arbitrary primers. The anchor primers were: XTH1, 5’TGCCGAAGC TTTTTTTTTTTA3’; XTH Differential display and sequencing
G3’; XTH3, 5’TGCCGAAGCTTTTTTTTTTTC3’. The arbitrary The fragments with significant differences between the primes were: DD10, 5’TGCCGAAGCTTTGGTAGC3’; DD12, control and treatment were selected, and one cDNA designed as 5’TGCCGAAGCTTGGAGAGT3’; DD18, 5’TGCCGAAGCT ADT3-8 (Fig. 1) was used to sequence. After the sequence TTGGTCAC3’; DD20, 5’TGCCGAAGCTTTGGTCAT3’; DD31, being edited manually to remove vector and ambiguous 5’TGCCGAAGCTTTGGTCTG3’; DD33, 5’TGCCGAAGCTT sequence, a fragment with final length of 256 bp was obtained GGAGGAA3’; DD34, 5’TGCCGAAGCTTTGGTGAC3’; DD35, 5’TGCCGAAGCTTTGGTGAG3’; DD36, 5’TGCCGAAGCT TGGAGGAT3’; DD38, 5’TGCCGAAGCTTGAT TGGC3’; Homologous analysis of nucleotide and protein sequence
DD54, 5’TGCCGAAGCTTTGGTTCC3’; DD60, 5’TGCCGAA Nucleotide sequence search by BLASTN revealed that PCR was carried out in a 20 µL reaction system including the cDNA was homologous to multiple ESTs, mRNAs and 2 µL cDNA products. The reaction mixture was subjected to genomic sequences of rice with high identities (Table 1). one cycle of denaturation at 94℃ for 5 min, annealing at 40℃ Interestingly, the homologous ESTs are mostly isolated from for 4 min and extension at 72℃ for 2 min; 15 cycles of the induced tissues and organs of rice, for example, the denaturation at 94℃ for 45 s, annealing at 54℃ for 2 min and CI491559 came from rice being induced by ACC, CI368508 extension at 72℃ for 1 min; and 20 cycles of denaturation at and CI366717 were identified in the callus, the other ESTs 94℃ for 45 s, annealing at 60℃ for 2 min and extension at 72℃ were reported in the stem treated by γ ray. This suggested that for 1 min; and final extension at 72℃ for 7 min. the cDNA was a AD-67 inducible gene in rice. The PCR products were denatured with formamide and xylene at 95℃ for 10 min, then 4 µL products were separated on 6% denaturing polyacrylamide gels. After silver staining [15], the bands showing differences between the control and induction treatment were excised and recovered by boiling. The cDNA fragments were re-amplified using the same PCR conditions and primers as above, and recovered with agarose gel electrophoresis. The purified fragments were linked to Fig. 1. The result of differential display (silver staining).
Pmd18-T (TaKaRa) vector, and the positive clones were The arrow shows the differential display band ADT3-8. The induction time was from 0 h (CK) to 5 days. >ADT3-8
5’TGCCGAAGCTTTTTTTTTTTCACATGACATTATATTTCATAAATGCAATTTAATGACGATGGTCCTCGCCAGATAATCAATTT
TGGGGAGAATTGAAACCCAATATTCAGCGATATTTTACATGGTTTCATATGCCTGCATTTGCAGACTTAATAGTTCAGCGGTT TTCCAATCACTATCCTTCTTTCAGCATCATGTGCTTCTCTAATATATACTTGCCTTCTTTGTACTTCTGGTCCTCACCAAAGCTT
CGGCA 3’
Fig. 2. Sequence of the differentially expressed fragment.
Black italic shows the primers of PCR, 5’ is the anchor primer and 3’ is the arbitrary primer. YIN De-suo, et al. Identification of a Herbicide Safener AD-67 Inducible cDNA in Rice 237 Table 1. Nucleotide sequences homologous with ADT3-8 in rice.
Fig. 3. RT-PCR analysis of inducible gene.
A. Yippee gene, the left is Marker DL2000; B. actin gene as database can provide mass bioinformation to scientists, which promote the rice research and release the researchers from the laborious experimental work to the efficient computational By BLASTX program, protein sequence analysis showed Yippee is an intracellular protein in Drosophila, which is that many Yippee genes in different species including yeast and conserved in eukaryote according to the reports [16]. This Tetrahymena thermophila shared the same function domain suggested that Yippee gene is an important gene. The gene with the cDNA (Table 2). Thus, we identified the mRNA expressed when the Drosophila was infected by pathogens, (GenBank accession No. XM_478909) as the transcript of the functioning as an immune related protein. The Yippee gene of ADT3-8 according the homologous sequences of the fragment. rice we identified according to the cDNA fragment is induced by safener AD-67, this is consistent with the results of previous RT-PCR analysis
studies, which concluded that safener could induce the Using the primers designed for the mRNA of rice Yippee expression of R gene [12]. Therefore, we deduced that the gene, RT-PCR result proved that the gene transcripts increased mechanisms of immune responses in rice and Drosophila might after induced by AD-67 (Fig. 3). The significant increase was found at 6 h after treatment, with maximum at 12 h after Although the function of Yippee gene was discussed in treatment. At 5 days after treated by AD-67, the expression some studies in Drosophila, its respondent in rice is still could also be detected. Moreover, sequencing of the RT-PCR unknown and should be studied. Moreover, if there is a products showed the nucleotide sequence of the 731 bp PCR regulator element in the 5’ upstream of the gene will also need product was identical to the mRNA (GenBank accession No. ACKNOWLEDGEMENTS
DISCUSSION
This study was supported by the National High Rice is the staple food crop, as well as the valuable model Technology Research and Development Program of China plant in cereal crops. The genome draft sequence of rice had (Grant No. 2003AA212030), and the Program for Changjiang been completed early in 2002, and the whole genome fine map Scholars and Innovative Research Team in University (PCSIRT) had also been published by different groups. The rice genome (Grant No. IRT0453). The authors thank to Dr. XU Zhengjun at Table 2. Protein sequences homologous with ADT3-8.
the Rice Research Institute, Sichuan Agricultural University for in mammalian cells and transgene mice. Proc Natl Acad Sci, USA, his suggestions and directions on the experiment. 1996, 93: 3346-3351.
Zuo J, Niu Q W, Chua N H. An estrogen receptor-based transactivator XVE mediate highly inducible gene expression in RERERENCES
transgenic plants. Plant J, 2000, 24: 265-273.
Hershey H P, Stoner T D. Isolation and characterization of cDNA Ren H W, Xiao F Z, Xing Z W. Chemically regulated clones for RNA species induced by substituted benzene- expression systems and their applications in transgenic plants. sulfonamides in corn. Plant Mol Biol, 1991, 17: 679-690.
Transg Res, 2003, 12: 529-540.
Hu T Z. The chemical-inducible expression system of plant genes. Gatz C. Chemical control of gene expression. Ann Rev Plant Mol Plant Breeding, 2003, 1(5): 731-736.
Physiol Plant Mol Biol, 1997, 48: 89-108.
Gatz C, Quail P H. Tn10-encoded tet repressor can regulate an 12 Gatz C, Lenk I. Promoters that respond to chemical inducers. operator-containing plant promoter. Proc Natl Acad Sci, USA, Trends Plant Sci, 1998, 3: 352-358.
1988, 85: 1394-1397.
13 Hatzios K K. Herbicide safeners: Effective inducers of plant Gatz C, Frohberg C, Wendenburg R. Stringent repression and defense gene-enzyme systems. Phytoparasitica, 2003, 31: 3-7.
homogeneous de-repression by tetracycline of a modified 14 de Veylder L, van Montagu M, Inze D. Herbicide safener- CaMV35S promoter in intact transgenic tobacco plants. Plant J, inducible gene expression in Arabidopsis thaliana. Plant Cell 1992, 2: 397-404.
Physiol, 1997, 38(5): 568-577.
5 Granger C L, Cyr R J. Characterization of the yeast Wang F G, Zhao J R, Guo J L, Sun S X. Review of research into copper-inducible promoter system in Arabidopsis thaliana. Plant establishing a DNA fingerprint database of new Chinese maize Cell Rep, 2001, 20: 227-234.
cultivars. Chinese Bull Bot, 2005, 22(1): 121-128. (in Chinese
Yves D, Alexis P, Gethin R, et al. The ethanol switch: A tool for tissue-specific gene induction during plant development. Plant J, 16 Roxstrom-Lindquist K, Faye I. The Drosophila gene reveals a 2003, 36: 918-930.
T, Chua N H. A glucocorticoid-mediated transcriptional novel family of putative zinc binding proteins highly conserved induction system in transgenic plants. Plant J, 1997, 11(3): 605-612.
among eukaryotes. Insect Mol Biol, 2001, 10: 77-86.
No D, Yao T P, Evans R M. Ecdysone-inducible gene expression

Source: http://ricesci.cn/fileup/PDF/E070311.pdf